Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03126

HP ID(1) HP03126
Gene ID(2) 1912
Gene Symbol finder PHC2
Protein Name polyhomeotic homolog 2 (Drosophila)
RefSeq NM_004427.3
Length of RefSeq (bp) 2566
Chromosome 1p34.3
Reference DDBJ accession
UniGene Hs.524271

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi04D11 pGCAP10 GAGACTCGCCGCATTGTCTCCGCGGCGGCTGCAGCCCTCGAGCGCCCGCCGCGCGCGCGC
RBd59E03 pGCAP10 GGTCCCGGCCTCGCGCCCCGGCCGCCCTTTGTTGACGCCGGCCAGGCCGGTGCGGTCGGA
RBdS051M18 pGCAP10 GGNNTTNTCTCCGCGGCGGCTGCAGCCCTCGAGCGCCCGCCGCGCGCGCGCGCGCAACCC
RBdS083O14 pGCAP10 TGGCNTTTTCTCCGCGGCGGCTGCAGCCCTCGAGCGCCCGCCGCGCGCGCGCGCGCAACC
RBdS154L08 pGCAP10 GAGACTCGCCGCATTGTCTCCGCGGCGGCTGCAGCCCTCGAGCGCCCGCCGCGCGCGCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl