Prev. |  KEGG KO K11457 > 

RIKEN DNA Bank Human Resource - PHC2

Gene ID NCBI Gene 1912 |  KEGG hsa:1912
Gene Symbol PHC2
Protein Name polyhomeotic homolog 2
Synonyms EDR2|HPH2|PH2
Ortholog resources KEGG ortholog (KEGG orthology K11457) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011107 IRAK027M19 pCMV-SPORT6 BC015450 NM_198040 Partial
HGY067452 IRAK168K12 pBluescriptR BC068573 NM_004427 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE019762 W01A049G18 pENTR-TOPO IRAK168K12 BC068573 NM_004427  
HGE019764 W01A049G20 pENTR-TOPO IRAK168K12 BC068573 NM_004427  
HGE019766 W01A049G22 pENTR-TOPO IRAK168K12 BC068573 NM_004427  
HGE019768 W01A049G24 pENTR-TOPO IRAK168K12 BC068573 NM_004427  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR161683 ARi04D11 pGCAP10 NM_004427.3  
GAGACTCGCCGCATTGTCTCCGCGGCGGCTGCAGCCCTCGAGCGCCCGCCGCGCGCGCGC
HKR383699 RBd59E03 pGCAP10 NM_004427.3  
GGTCCCGGCCTCGCGCCCCGGCCGCCCTTTGTTGACGCCGGCCAGGCCGGTGCGGTCGGA
HKR420706 RBdS051M18 pGCAP10 NM_004427.3  
GGNNTTNTCTCCGCGGCGGCTGCAGCCCTCGAGCGCCCGCCGCGCGCGCGCGCGCAACCC
HKR433550 RBdS083O14 pGCAP10 NM_004427.3  
TGGCNTTTTCTCCGCGGCGGCTGCAGCCCTCGAGCGCCCGCCGCGCGCGCGCGCGCAACC
HKR461872 RBdS154L08 pGCAP10 NM_004427.3  
GAGACTCGCCGCATTGTCTCCGCGGCGGCTGCAGCCCTCGAGCGCCCGCCGCGCGCGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl