Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03074

HP ID(1) HP03074
Gene ID(2) 5688
Gene Symbol finder PSMA7
Protein Name proteasome (prosome, macropain) subunit, alpha type, 7
RefSeq NM_002792.2
Length of RefSeq (bp) 984
Chromosome 20q13.33
Reference DDBJ accession
UniGene Hs.233952

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe23C11 pKA1U5 GGCCTGACGCCGCCCGTCGCCGGCAGCGCAGGACACGGCGCCGAGGGTGGGGCGCGGGCG
ARe25H05 pKA1U5 GGAGAGTCGCGGCGGAAGGAGCCCGGCCGCCGCCCGCCGGCATGAGCTACGACCGCGCCA
ARe37E09 pKA1U5 GGGCAGCGCAGGACACGGCGCCGAGGGTGGGGCGCGGGCGTAGTGGCGCCGGGAGTCGCG
ARe51H03 pKA1U5 AGGGAAGGAGCCCGGCCGCCGCCCGCCGGCATGAGCTACGACCGCGCCATCACCGTCTTC
ARi24A09 pGCAP10 GGTAGTGGCGCCGGGAGTCGCGGGTGCGCGCAGGCCGTGAGTGTGNNCTTTTGAGAGTCG
ARiS191P08 pGCAP10 GGTGGCGCCGGGAGTCGCGGGTGCGCGCAGGCCGTGAGTGTGCGCTTTTGAGAGTCGCGG
RBd85G11 pGCAP10 GAGGCCGTGAGTGTGCGCTTTTGAGAGTCGCGGCGGAAGGAGCCCGGCCGCCGCCCGCCG
RBdS013H03 pGCAP10 GACACGGCGCCGAGGGTGGGGCGCGGGCGTAGTGGCGCCGGGAGTCGCGGGTGCGCGCAG
RBdS013N18 pGCAP10 GANTCNNGGGTGCGCGCAGGCCGTGAGTGTGCGCTTTTGAGAGTCGCGGCGGAAGGAGCC
RBdS013P07 pGCAP10 GCGGCAGCGCAGGACACGGCGCCGAGGGTGGGGCGCGGGCGTAGTGGCGCCGGGAGTCGC
RBdS075I20 pGCAP10 GGCCGAGGGTGGGGCGCGGGCGTAGTGGCGCCGGGAGTCGCGGGTGCGCGCAGGCCGTGA
RBdS081G15 pGCAP10 GGGCCGCCGCCCGCCGGCNTGANCTACGACCGCGCCATCACCGTCTTCTCGCCCGACNGC
RBdS110H01 pGCAP10 GGCGCTTTTGAGAGTCGCGGCGGAAGGAGCCCGGCCGCCGCCCGCCGGCATGAGCTACGA
RBdS154E23 pGCAP10 GGGGAGTCGCGGGTGCGCGCAGGCCGTGAGTGTGCGCTTTTGAGAGTCGCGGCGGAAGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl