Prev. |  KEGG KO K02731 > 

RIKEN DNA Bank Human Resource - PSMA7

Gene ID NCBI Gene 5688 |  KEGG hsa:5688
Gene Symbol PSMA7
Protein Name proteasome subunit alpha 7
Synonyms C6|HEL-S-276|HSPC|RC6-1|XAPC7
Ortholog resources KEGG ortholog (KEGG orthology K02731) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083563 IRAL008P03 pOTB7 BC001895 NM_002792 Partial/var
HGY083709 IRAL009E13 pOTB7 BC004427 NM_002792 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE005087 W01A012L23 pENTR-TOPO IRAL009E13 BC004427 NM_002792  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049259 ARe23C11 pKA1U5 NM_002792.2  
GGCCTGACGCCGCCCGTCGCCGGCAGCGCAGGACACGGCGCCGAGGGTGGGGCGCGGGCG
HKR050173 ARe25H05 pKA1U5 NM_002792.2  
GGAGAGTCGCGGCGGAAGGAGCCCGGCCGCCGCCCGCCGGCATGAGCTACGACCGCGCCA
HKR054905 ARe37E09 pKA1U5 NM_002792.2  
GGGCAGCGCAGGACACGGCGCCGAGGGTGGGGCGCGGGCGTAGTGGCGCCGGGAGTCGCG
HKR060571 ARe51H03 pKA1U5 NM_002792.2  
AGGGAAGGAGCCCGGCCGCCGCCCGCCGGCATGAGCTACGACCGCGCCATCACCGTCTTC
HKR169609 ARi24A09 pGCAP10 NM_002792.2  
GGTAGTGGCGCCGGGAGTCGCGGGTGCGCGCAGGCCGTGAGTGTGNNCTTTTGAGAGTCG
HKR276768 ARiS191P08 pGCAP10 NM_002792.2  
GGTGGCGCCGGGAGTCGCGGGTGCGCGCAGGCCGTGAGTGTGCGCTTTTGAGAGTCGCGG
HKR394155 RBd85G11 pGCAP10 NM_002792.2  
GAGGCCGTGAGTGTGCGCTTTTGAGAGTCGCGGCGGAAGGAGCCCGGCCGCCGCCCGCCG
HKR405371 RBdS013H03 pGCAP10 NM_002792.2  
GACACGGCGCCGAGGGTGGGGCGCGGGCGTAGTGGCGCCGGGAGTCGCGGGTGCGCGCAG
HKR405530 RBdS013N18 pGCAP10 NM_002792.2  
GANTCNNGGGTGCGCGCAGGCCGTGAGTGTGCGCTTTTGAGAGTCGCGGCGGAAGGAGCC
HKR405567 RBdS013P07 pGCAP10 NM_002792.2  
GCGGCAGCGCAGGACACGGCGCCGAGGGTGGGGCGCGGGCGTAGTGGCGCCGGGAGTCGC
HKR430212 RBdS075I20 pGCAP10 NM_002792.2  
GGCCGAGGGTGGGGCGCGGGCGTAGTGGCGCCGGGAGTCGCGGGTGCGCGCAGGCCGTGA
HKR432559 RBdS081G15 pGCAP10 NM_002792.2  
GGGCCGCCGCCCGCCGGCNTGANCTACGACCGCGCCATCACCGTCTTCTCGCCCGACNGC
HKR444169 RBdS110H01 pGCAP10 NM_002792.2  
GGCGCTTTTGAGAGTCGCGGCGGAAGGAGCCCGGCCGCCGCCCGCCGGCATGAGCTACGA
HKR461719 RBdS154E23 pGCAP10 NM_002792.2  
GGGGAGTCGCGGGTGCGCGCAGGCCGTGAGTGTGCGCTTTTGAGAGTCGCGGCGGAAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl