Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03014

HP ID(1) HP03014
Gene ID(2) 23559
Gene Symbol finder WBP1
Protein Name WW domain binding protein 1
RefSeq NM_012477.2
Length of RefSeq (bp) 1183
Chromosome 2p12
Reference DDBJ accession
UniGene Hs.516114

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd96H01 pGCAP10 GGGTGGAGTTCTGCCCGGATGGAAGCTCCGGCCGCGGAGTGATGGTGGCCTCAGCGAAGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl