Prev. | 

RIKEN DNA Bank Human Resource - WBP1

Gene ID NCBI Gene 23559 |  KEGG hsa:23559
Gene Symbol WBP1
Protein Name WW domain binding protein 1
Synonyms WBP-1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX066441 IRAK166B17 pCMV-SPORT6 BC071626 NM_012477 Full
HGY090772 IRAL026P12 pOTB7 BC010012 NM_012477
HGY100159 IRAL050G15 pOTB7 BC064482 NM_012477 Full
HGY103510 IRAL058M22 pOTB7 BC071850 NM_012477 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR398569 RBd96H01 pGCAP10 NM_012477.2  
GGGTGGAGTTCTGCCCGGATGGAAGCTCCGGCCGCGGAGTGATGGTGGCCTCAGCGAAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl