Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02920

HP ID(1) HP02920
Gene ID(2) 114049
Gene Symbol finder WBSCR22
Protein Name Williams Beuren syndrome chromosome region 22
RefSeq NM_017528.2
Length of RefSeq (bp) 1258
Chromosome 7q11.23
Reference DDBJ accession
UniGene Hs.647063

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe35D02 pKA1U5 GGCAGGTGTGCTGCTGAGGCGTGAGAATGGCGTCCCGCGGCCGGCGTCCGGAGCATGGCG
ARi17B04 pGCAP10 GAGTCGCAGGTGTGCTGCTGAGGCGTGAGAATGGCGTCCCGCGGCCGGCGTCCGGAGCAT
ARiS045E13 pGCAP10 GAGGTGTGCTGCTGAGGCGTGAGAATGGCGTCCCGCGGCCGGCGTCCGGAGCATGGCGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl