Prev. |  KEGG KO K19306 > 

RIKEN DNA Bank Human Resource - BUD23

Gene ID NCBI Gene 114049 |  KEGG hsa:114049
Gene Symbol BUD23
Protein Name BUD23 rRNA methyltransferase and ribosome maturation factor
Synonyms HASJ4442|HUSSY-3|MERM1|PP3381|WBMT|WBSCR22
Ortholog resources KEGG ortholog (KEGG orthology K19306) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001273 IRAK003D01 pCMV-SPORT6 BC000169 NM_017528 Full
HGY083270 IRAL008C22 pOTB7 BC001780 NM_017528 Full
HGY090879 IRAL027D07 pOTB7 BC011696 NM_017528 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR054074 ARe35D02 pKA1U5 NM_017528.2  
GGCAGGTGTGCTGCTGAGGCGTGAGAATGGCGTCCCGCGGCCGGCGTCCGGAGCATGGCG
HKR166828 ARi17B04 pGCAP10 NM_017528.2  
GAGTCGCAGGTGTGCTGCTGAGGCGTGAGAATGGCGTCCCGCGGCCGGCGTCCGGAGCAT
HKR218109 ARiS045E13 pGCAP10 NM_017528.2  
GAGGTGTGCTGCTGAGGCGTGAGAATGGCGTCCCGCGGCCGGCGTCCGGAGCATGGCGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl