Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02917

HP ID(1) HP02917
Gene ID(2) 23654
Gene Symbol finder PLXNB2
Protein Name plexin B2
RefSeq NM_012401.2
Length of RefSeq (bp) 6369
Chromosome 22q13.33
Reference DDBJ accession
UniGene Hs.3989

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe49A01 pKA1U5 GAAAGGCCCCGNTCTCCATGGCAGCAGCGCGGGCCAGAGCGCAGCGCCGAGCGCGGCCCG
ARe64D05 pKA1U5 GGCCATCGAGCCTTGGCGGCGGACGTGCAGAGAATCTCGATGCTGGCCTGGAGCAGAAAC
ARiS049D12 pGCAP10 CGGCCGGCCGATGGCCATCNAGCCTTGGCGGCGGACGTGCAGAGAATCTCGATGCTGGCC
ARiS055C16 pGCAP10 GGGGCCAGAGCGCAGCGCCGAGCGCGGCCCGGGCGCCATCGAGCCTTGGCGGCGGACGTG
ARiS085B08 pGCAP10 GTCGGAGGACTTAGGTAATGGCCGGCTGTGCGATCCGATGTGCCCGACGCCAGAGAATCT
ARiS085L16 pGCAP10 GGCGGNCCACANCGCAGCNCCGAGCGCGACCCGGGCGCCATCGAGCCTTGGCGGCGGACG
RBdS156O01 pGCAP10 GACACACAAAGGCCCCGTCTCCATGGCAGCAGCGCGGGCCAGAGCGCAGCGCCGAGCGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl