Prev. |  KEGG KO K06821 > 

RIKEN DNA Bank Human Resource - PLXNB2

Gene ID NCBI Gene 23654 |  KEGG hsa:23654
Gene Symbol PLXNB2
Protein Name plexin B2
Synonyms MM1|Nbla00445|PLEXB2|dJ402G11.3
Ortholog resources KEGG ortholog (KEGG orthology K06821) in the DNA Bank
Featured content Axon guidance - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086185 IRAL015H17 pOTB7 BC004542 XM_938245 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR059601 ARe49A01 pKA1U5 NM_012401.2  
GAAAGGCCCCGNTCTCCATGGCAGCAGCGCGGGCCAGAGCGCAGCGCCGAGCGCGGCCCG
HKR065677 ARe64D05 pKA1U5 NM_012401.2 done
GGCCATCGAGCCTTGGCGGCGGACGTGCAGAGAATCTCGATGCTGGCCTGGAGCAGAAAC
HKR219684 ARiS049D12 pGCAP10 NM_012401.2  
CGGCCGGCCGATGGCCATCNAGCCTTGGCGGCGGACGTGCAGAGAATCTCGATGCTGGCC
HKR222064 ARiS055C16 pGCAP10 NM_012401.2  
GGGGCCAGAGCGCAGCGCCGAGCGCGGCCCGGGCGCCATCGAGCCTTGGCGGCGGACGTG
HKR234032 ARiS085B08 pGCAP10 NM_012401.2  
GTCGGAGGACTTAGGTAATGGCCGGCTGTGCGATCCGATGTGCCCGACGCCAGAGAATCT
HKR234280 ARiS085L16 pGCAP10 NM_012401.2  
GGCGGNCCACANCGCAGCNCCGAGCGCGACCCGGGCGCCATCGAGCCTTGGCGGCGGACG
HKR462737 RBdS156O01 pGCAP10 NM_012401.2  
GACACACAAAGGCCCCGTCTCCATGGCAGCAGCGCGGGCCAGAGCGCAGCGCCGAGCGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl