Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02900

HP ID(1) HP02900
Gene ID(2) 5518
Gene Symbol finder PPP2R1A
Protein Name protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform
RefSeq NM_014225.4
Length of RefSeq (bp) 2400
Chromosome 19q13.33
Reference DDBJ accession
UniGene Hs.467192

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe21B11 pKA1U5 GNTTCTTCCCCCAGCATTGCCCCCCCCACGGTTTCAGTCACAGCGCTGGCNGCAGNTCTG
ARe92H08 pKA1U5 GTCAGCACAGCGCTGGCCGCAGTCTGACAGGAAAGGGACGGAGCCAAGATGGCGGCGGCC
ARi22G01 pGCAP10 GAGCACAGCGCTGGCCGCAGTCTGACAGGAAAGGGACGGAGCCAAGATGGCGGCGGCCGA
ARiS020F11 pGCAP10 GAGCACAGCGCTGGCCGCAGTCTGACAGGAAAGGGACGGAGCCAAGATGGCGGCGGCCGA
ARiS109O19 pGCAP10 GGTTTCNNCNCAGCGCTGGCCGCAGTCTGACAGGAAAGGGACGGAGCCAAGATGGCGGCG
ARiS191P23 pGCAP10 GAGCACAGCGCTGGCCGCAGTCTGACAGGAAAGGGACGGAGCCAAGATGGCGGCGGCCGA
RBb45C09 pGCAP1 GCTGACAGGAAAGGGACGGAGCCAAGATGGCGGCGGCCGACGGCGACGACTCGCTGTACC
RBb72D06 pGCAP1 AGCATTGCCCCCCCCTACGTTTCAGCACAGCGCTGGCCGCAGTCTGACAGGAAAGGGACG
RBd30A01 pGCAP10 GGACAGGAAAGGGACGGAGCCAAGATGGCGGCGGCCGACGGCGACGACTCGCTGTACCCC
RBd86D04 pGCAP10 GCTTCTTCTCCCAGCATTGCCCCCCCCTACGTTTCAGCACAGCGCTGGCCGCAGTCTGAC
RBdS083M02 pGCAP10 GAGCGCTGGCCGCAGTCTGACAGGAAAGGGACGGAGCCAAGATGGCGGCGGCCGACGGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl