Prev. |  KEGG KO K03456 > 

RIKEN DNA Bank Human Resource - PPP2R1A

Gene ID NCBI Gene 5518 |  KEGG hsa:5518
Gene Symbol PPP2R1A
Protein Name protein phosphatase 2 scaffold subunit Aalpha
Synonyms MRD36|PP2A-Aalpha|PP2AA|PP2AAALPHA|PR65A
Ortholog resources KEGG ortholog (KEGG orthology K03456) in the DNA Bank
Featured content Hippo signaling (human)
Featured content Sphingolipid signaling pathway (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081419 IRAL003J03 pOTB7 BC001537 NM_014225 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048435 ARe21B11 pKA1U5 NM_014225.4  
GNTTCTTCCCCCAGCATTGCCCCCCCCACGGTTTCAGTCACAGCGCTGGCNGCAGNTCTG
HKR076976 ARe92H08 pKA1U5 NM_014225.4  
GTCAGCACAGCGCTGGCCGCAGTCTGACAGGAAAGGGACGGAGCCAAGATGGCGGCGGCC
HKR168945 ARi22G01 pGCAP10 NM_014225.4  
GAGCACAGCGCTGGCCGCAGTCTGACAGGAAAGGGACGGAGCCAAGATGGCGGCGGCCGA
HKR208131 ARiS020F11 pGCAP10 NM_014225.4  
GAGCACAGCGCTGGCCGCAGTCTGACAGGAAAGGGACGGAGCCAAGATGGCGGCGGCCGA
HKR243955 ARiS109O19 pGCAP10 NM_014225.4  
GGTTTCNNCNCAGCGCTGGCCGCAGTCTGACAGGAAAGGGACGGAGCCAAGATGGCGGCG
HKR276783 ARiS191P23 pGCAP10 NM_014225.4  
GAGCACAGCGCTGGCCGCAGTCTGACAGGAAAGGGACGGAGCCAAGATGGCGGCGGCCGA
HKR338057 RBb45C09 pGCAP1 NM_014225.4  
GCTGACAGGAAAGGGACGGAGCCAAGATGGCGGCGGCCGACGGCGACGACTCGCTGTACC
HKR348878 RBb72D06 pGCAP1 NM_014225.4  
AGCATTGCCCCCCCCTACGTTTCAGCACAGCGCTGGCCGCAGTCTGACAGGAAAGGGACG
HKR372001 RBd30A01 pGCAP10 NM_014225.4  
GGACAGGAAAGGGACGGAGCCAAGATGGCGGCGGCCGACGGCGACGACTCGCTGTACCCC
HKR394476 RBd86D04 pGCAP10 NM_014225.4  
GCTTCTTCTCCCAGCATTGCCCCCCCCTACGTTTCAGCACAGCGCTGGCCGCAGTCTGAC
HKR433490 RBdS083M02 pGCAP10 NM_014225.4  
GAGCGCTGGCCGCAGTCTGACAGGAAAGGGACGGAGCCAAGATGGCGGCGGCCGACGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl