Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02856

HP ID(1) HP02856
Gene ID(2) 4907
Gene Symbol finder NT5E
Protein Name 5'-nucleotidase, ecto (CD73)
RefSeq NM_002526.2
Length of RefSeq (bp) 4087
Chromosome 6q14-q21
Reference DDBJ accession
UniGene Hs.153952

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe09F11 pKA1U5 GGCCCTAGCTGCTCGCCCCTACTCGCCGGCACTCGCCCGGCTCGCCCGCTTTCGCACCCA
ARe50H11 pKA1U5 GCCCGCCCCTCCAGCCGGGGCACCGAGCCCCGGCCCTAGCTGCTCGCCCCTACTCGCCGG
ARe60A05 pKA1U5 GACTCGCCGGCACTCGCCCGGCTCGCCCGCTTTCGCACCCAGTTCACGCGCCACAGCTAT
ARf03G03 pKA1U5 TGTCTCGCCGGCACTCGCCCGGCTCGCCCGCCTTTCNTACCCAGNTTCACGCGCCACAGC
ARi22C11 pGCAP10 GGCCCCGGCCCTAGCTGCTCGCCCCTACTCGCCGGCACTCGCCCGGCTCGCCCGCTTTCG
ARiS122F01 pGCAP10 GACTCGCCCGGCTCGCCCGCTTTCGCACCCAGTTCACGCGCCACAGCTATGTGTCCCCGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl