Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NT5E

Gene ID (NCBI) 4907
Gene Symbol NT5E
Protein Name 5'-nucleotidase, ecto (CD73)
Synonyms CALJA|CD73|E5NT|NT|NT5|NTE|eN|eNT
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX056336 IRAK140N24 pCMV-SPORT6 BC065937 NM_002526 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR043731 ARe09F11 pKA1U5 NM_002526.2
GGCCCTAGCTGCTCGCCCCTACTCGCCGGCACTCGCCCGGCTCGCCCGCTTTCGCACCCA
HKR081347 ARf03G03 pKA1U5 NM_002526.2
TGTCTCGCCGGCACTCGCCCGGCTCGCCCGCCTTTCNTACCCAGNTTCACGCGCCACAGC
HKR168859 ARi22C11 pGCAP10 NM_002526.2
GGCCCCGGCCCTAGCTGCTCGCCCCTACTCGCCGGCACTCGCCCGGCTCGCCCGCTTTCG
HKR060179 ARe50H11 pKA1U5 NM_002526.2
GCCCGCCCCTCCAGCCGGGGCACCGAGCCCCGGCCCTAGCTGCTCGCCCCTACTCGCCGG
HKR064005 ARe60A05 pKA1U5 NM_002526.2
GACTCGCCGGCACTCGCCCGGCTCGCCCGCTTTCGCACCCAGTTCACGCGCCACAGCTAT
HKR248921 ARiS122F01 pGCAP10 NM_002526.2
GACTCGCCCGGCTCGCCCGCTTTCGCACCCAGTTCACGCGCCACAGCTATGTGTCCCCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.02

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl