Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02834

HP ID(1) HP02834
Gene ID(2) 9798
Gene Symbol finder KIAA0174
Protein Name KIAA0174
RefSeq NM_014761.2
Length of RefSeq (bp) 2377
Chromosome 16q22.3
Reference DDBJ accession
UniGene Hs.232194

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe46B11 pKA1U5 GGCCATTTTGGATGGTGAACCCTGAAGTCGGTGTCTGCTGCGTTCACGGCAGGATTCGGT
ARi45E07 pGCAP10 GGGTGGTGAACCCTGAAGTCGGTGTCTGCTGCGTTCACGGCAGGATTCGGTTAGGAGGAA
RBd19D04 pGCAP10 GATTTTGGATGGTGAACCCTGAAGTCGGTGTCTGCTGCGTTCACGGCAGGATTCGGTTAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl