Prev. | Human A to Z list > I > 

RIKEN DNA Bank Human Resource - IST1

Gene ID (NCBI) 9798
Gene Symbol IST1
Protein Name increased sodium tolerance 1 homolog (yeast)
Synonyms OLC1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080437 IRAL001B13 pOTB7 BC000430 NM_014761
HGY082741 IRAL006O05 pOTB7 BC000116 NM_014761 Full/var
HGY083897 IRAL009M09 pOTB7 BC004359 NM_014761 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR058435 ARe46B11 pKA1U5 NM_014761.2  
GGCCATTTTGGATGGTGAACCCTGAAGTCGGTGTCTGCTGCGTTCACGGCAGGATTCGGT
HKR178103 ARi45E07 pGCAP10 NM_014761.2  
GGGTGGTGAACCCTGAAGTCGGTGTCTGCTGCGTTCACGGCAGGATTCGGTTAGGAGGAA
HKR367676 RBd19D04 pGCAP10 NM_014761.2  
GATTTTGGATGGTGAACCCTGAAGTCGGTGTCTGCTGCGTTCACGGCAGGATTCGGTTAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl