Prev. |  KEGG KO K19476 > 

RIKEN DNA Bank Human Resource - IST1

Gene ID NCBI Gene 9798 |  KEGG hsa:9798
Gene Symbol IST1
Protein Name IST1 factor associated with ESCRT-III
Synonyms CHMP8|OLC1
Featured content Endocytosis (human)
Ortholog resource in our bank

  IST1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080437 IRAL001B13 pOTB7 BC000430 NM_014761
HGY082741 IRAL006O05 pOTB7 BC000116 NM_014761 Full/var
HGY083897 IRAL009M09 pOTB7 BC004359 NM_014761 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR058435 ARe46B11 pKA1U5 NM_014761.2  
GGCCATTTTGGATGGTGAACCCTGAAGTCGGTGTCTGCTGCGTTCACGGCAGGATTCGGT
HKR178103 ARi45E07 pGCAP10 NM_014761.2  
GGGTGGTGAACCCTGAAGTCGGTGTCTGCTGCGTTCACGGCAGGATTCGGTTAGGAGGAA
HKR367676 RBd19D04 pGCAP10 NM_014761.2  
GATTTTGGATGGTGAACCCTGAAGTCGGTGTCTGCTGCGTTCACGGCAGGATTCGGTTAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl