Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02815

HP ID(1) HP02815
Gene ID(2) 56941
Gene Symbol finder C3orf37
Protein Name chromosome 3 open reading frame 37
RefSeq NM_001006109.1
Length of RefSeq (bp) 1809
Chromosome 3q21.3
Reference DDBJ accession
UniGene Hs.458320

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd17E05 pGCAP10 GAGAGTCGAGGGAGGTGACGCGCGCTGCCGGGGCGAGGTTGCGAGGGGCGGTGTTGAAGA
RBd39E04 pGCAP10 GAGAGGCCCGAGCGGACGCGAGGCGACGCGGAGAGGGCGGCCTGGGCCGAAGTGAGGCGA
RBd97C04 pGCAP10 GAGAGGCCCGAGCGGACGCGAGGCGACGCGGAGAGGGCGGCCTGGGCCGAAGTGAGGCGA
RBdS110M04 pGCAP10 GAGAGGGGAGCAGAGGCCCGAGCGGACGCGAGGCGACGCGGAGAGGGCGGCCTGGGCCGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl