Prev. | 

RIKEN DNA Bank Human Resource - HMCES

Gene ID NCBI Gene 56941 |  KEGG hsa:56941
Gene Symbol HMCES
Protein Name 5-hydroxymethylcytosine binding, ES cell specific
Synonyms C3orf37|DC12|SRAPD1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04575 SEREX clone NGO-Br-70 (ID 1314, 1315) #1 SEREX clone NGO-Br-70 (ID 1314, 1315) #1

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY090620 IRAL026J04 pOTB7 BC009993 NM_020187 Full/var
HGY091042 IRAL027K02 pOTB7 BC010125 NM_020187 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE099216 M01C048A16 pDONR221 MGC13-F08 BC009993 NM_020187  
HGE099264 M01C048C16 pDONR221 MGC13-F08 BC009993 NM_020187  
HGE099312 M01C048E16 pDONR221 MGC13-F08 BC009993 NM_020187  
HGE099360 M01C048G16 pDONR221 MGC13-F08 BC009993 NM_020187  
HGE099408 M01C048I16 pDONR221 MGC13-F08 BC009993 NM_020187  
HGE099456 M01C048K16 pDONR221 MGC13-F08 BC009993 NM_020187  
HGE099504 M01C048M16 pDONR221 MGC13-F08 BC009993 NM_020187  
HGE099552 M01C048O16 pDONR221 MGC13-F08 BC009993 NM_020187  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR366901 RBd17E05 pGCAP10 NM_001006109.1  
GAGAGTCGAGGGAGGTGACGCGCGCTGCCGGGGCGAGGTTGCGAGGGGCGGTGTTGAAGA
HKR375700 RBd39E04 pGCAP10 NM_001006109.1  
GAGAGGCCCGAGCGGACGCGAGGCGACGCGGAGAGGGCGGCCTGGGCCGAAGTGAGGCGA
HKR398852 RBd97C04 pGCAP10 NM_001006109.1  
GAGAGGCCCGAGCGGACGCGAGGCGACGCGGAGAGGGCGGCCTGGGCCGAAGTGAGGCGA
HKR444292 RBdS110M04 pGCAP10 NM_001006109.1  
GAGAGGGGAGCAGAGGCCCGAGCGGACGCGAGGCGACGCGGAGAGGGCGGCCTGGGCCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl