Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02748

HP ID(1) HP02748
Gene ID(2) 55696
Gene Symbol finder RBM22
Protein Name RNA binding motif protein 22
RefSeq NM_018047.2
Length of RefSeq (bp) 2352
Chromosome 5q33.1
Reference DDBJ accession
UniGene Hs.713564

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARh03D02 pGCAP1 GGGACGCTCTCAAGATGGCGACCTCTCTGGGTTCCAACACCTACAACAGGCAG
RBdS014K22 pGCAP10 AAATAAGACGCCGACCGGCGCGGCGCTAGCCTCGGGGCTTGACGGGATTGTGGCGGTCCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl