Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02745

HP ID(1) HP02745
Gene ID(2) 8500
Gene Symbol finder PPFIA1
Protein Name protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1
RefSeq NM_177423.1
Length of RefSeq (bp) 3945
Chromosome 11q13.3
Reference DDBJ accession
UniGene Hs.530749

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe49G12 pKA1U5 GGCCGCCAGTGTCCGGCCGCGGGCCGGCCTTACCTTTTTGGGGCGGCGGGCCCCGGGGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl