Prev. | 

RIKEN DNA Bank Human Resource - PPFIA1

Gene ID NCBI Gene 8500 |  KEGG hsa:8500
Gene Symbol PPFIA1
Protein Name PTPRF interacting protein alpha 1
Synonyms LIP.1|LIP1|LIPRIN
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY012891 IRAK032D19 pBluescriptR BC034046 NM_003626 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE089214 M01C023A14 pDONR221 MGC01-B07 BC034046 ENST00000253925  
HGE089262 M01C023C14 pDONR221 MGC01-B07 BC034046 ENST00000253925  
HGE089310 M01C023E14 pDONR221 MGC01-B07 BC034046 ENST00000253925  
HGE089358 M01C023G14 pDONR221 MGC01-B07 BC034046 ENST00000253925  
HGE089406 M01C023I14 pDONR221 MGC01-B07 BC034046 ENST00000253925  
HGE089454 M01C023K14 pDONR221 MGC01-B07 BC034046 ENST00000253925  
HGE089502 M01C023M14 pDONR221 MGC01-B07 BC034046 ENST00000253925  
HGE089550 M01C023O14 pDONR221 MGC01-B07 BC034046 ENST00000253925  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR059756 ARe49G12 pKA1U5 NM_177423.1 VA done
GGCCGCCAGTGTCCGGCCGCGGGCCGGCCTTACCTTTTTGGGGCGGCGGGCCCCGGGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl