Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02727

HP ID(1) HP02727
Gene ID(2) 4924
Gene Symbol finder NUCB1
Protein Name nucleobindin 1
RefSeq NM_006184.4
Length of RefSeq (bp) 2298
Chromosome 19q13.33
Reference DDBJ accession
UniGene Hs.631602

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe16C10 pKA1U5 GCTGGAAAACGCCCTCTGCGGTGAAGGAGAGACCACACTGCCATGCCTCCCTCTGGGCCC
ARi04D08 pGCAP10 GGGAAAACGCCCTCTGCGGTGAAGGAGAGACCACACTGCCATGCCTCCCTCTGGGCCCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl