Prev. |  KEGG KO K20371 > 

RIKEN DNA Bank Human Resource - NUCB1

Gene ID NCBI Gene 4924 |  KEGG hsa:4924
Gene Symbol NUCB1
Protein Name nucleobindin 1
Synonyms CALNUC|NUC
Ortholog resource in our bank

  NUCB1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080558 IRAL001G14 pOTB7 BC002356 NM_006184

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR046458 ARe16C10 pKA1U5 NM_006184.4  
GCTGGAAAACGCCCTCTGCGGTGAAGGAGAGACCACACTGCCATGCCTCCCTCTGGGCCC
HKR161680 ARi04D08 pGCAP10 NM_006184.4  
GGGAAAACGCCCTCTGCGGTGAAGGAGAGACCACACTGCCATGCCTCCCTCTGGGCCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl