Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02707

HP ID(1) HP02707
Gene ID(2) 6675
Gene Symbol finder UAP1
Protein Name UDP-N-acteylglucosamine pyrophosphorylase 1
RefSeq NM_003115.4
Length of RefSeq (bp) 2344
Chromosome 1q23.3
Reference DDBJ accession
UniGene Hs.492859

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe87D06 pKA1U5 GAGTGGCCGCGCGGAAGGAGCTGGAGACGGTCGTAGCTGCGGTCGCGCCGAGAAAGGTTT
ARi68F01 pGCAP10 GGTGTCTGGGCGGTCGGCTTCCACTCCTTCAGGCGTCGGCAGCCACTAGTCGTGGCGAGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl