Prev. |  KEGG KO K00972 > 

RIKEN DNA Bank Human Resource - UAP1

Gene ID NCBI Gene 6675 |  KEGG hsa:6675
Gene Symbol UAP1
Protein Name UDP-N-acetylglucosamine pyrophosphorylase 1
Synonyms AGX|AGX1|AGX2|SPAG2
Ortholog resource in our bank

  UAP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY090491 IRAL026D19 pOTB7 BC009377 NM_003115

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR074878 ARe87D06 pKA1U5 NM_003115.4  
GAGTGGCCGCGCGGAAGGAGCTGGAGACGGTCGTAGCTGCGGTCGCGCCGAGAAAGGTTT
HKR187321 ARi68F01 pGCAP10 NM_003115.4  
GGTGTCTGGGCGGTCGGCTTCCACTCCTTCAGGCGTCGGCAGCCACTAGTCGTGGCGAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl