Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02706

HP ID(1) HP02706
Gene ID(2) 754
Gene Symbol finder PTTG1IP
Protein Name pituitary tumor-transforming 1 interacting protein
RefSeq NM_004339.2
Length of RefSeq (bp) 2737
Chromosome 21q22.3
Reference DDBJ accession
UniGene Hs.474010

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe62H07 pKA1U5 GGGGCGGAGACCGCTTGTGCTGGAGTCGGAGTTGTAACGCTCCACTGACTGATAGAGCGA
ARiS008N22 pGCAP10 GGGAGACCGCTTGTGCTGGAGTCGGAGTTGTAACGCTCCACTGACTGATAGAGCGACCGG
ARiS087A16 pGCAP10 GNCNNCCGGCGCCGCGGCNGTTCCGGGCGGAGACCGCTTGTGCTGGAGTCGGAGTTGTAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl