Prev. | 

RIKEN DNA Bank Human Resource - PTTG1IP

Gene ID NCBI Gene 754 |  KEGG hsa:754
Gene Symbol PTTG1IP
Protein Name PTTG1 interacting protein
Synonyms C21orf1|C21orf3|PBF
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008335 IRAK020N23 pCMV-SPORT6 BC020983 NM_004339 Full
HGX008437 IRAK021B13 pCMV-SPORT6 BC012858 NM_004339 Full
HGX008482 IRAK021D10 pCMV-SPORT6 BC013729 NM_004339
HGX008585 IRAK021H17 pCMV-SPORT6 BC034250 NM_004339 Full
HGY019427 IRAK048J11 pBluescriptR BC031097 NM_004339 Full
HGY080704 IRAL001M16 pOTB7 BC000415 NM_004339 Full
HGY083760 IRAL009G16 pOTB7 BC019295 NM_004339 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE051020 W01A127J04 pENTR-TOPO IRAL001M16 BC000415 NM_004339  
HGE051022 W01A127J06 pENTR-TOPO IRAL001M16 BC000415 NM_004339  
HGE051028 W01A127J12 pENTR-TOPO IRAL001M16 BC000415 NM_004339  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR064975 ARe62H07 pKA1U5 NM_004339.2  
GGGGCGGAGACCGCTTGTGCTGGAGTCGGAGTTGTAACGCTCCACTGACTGATAGAGCGA
HKR203534 ARiS008N22 pGCAP10 NM_004339.2  
GGGAGACCGCTTGTGCTGGAGTCGGAGTTGTAACGCTCCACTGACTGATAGAGCGACCGG
HKR234816 ARiS087A16 pGCAP10 NM_004339.2  
GNCNNCCGGCGCCGCGGCNGTTCCGGGCGGAGACCGCTTGTGCTGGAGTCGGAGTTGTAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl