Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02684

HP ID(1) HP02684
Gene ID(2) 7345
Gene Symbol finder UCHL1
Protein Name ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)
RefSeq NM_004181.3
Length of RefSeq (bp) 1110
Chromosome 4p14
Reference DDBJ accession
UniGene Hs.518731

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe21H04 pKA1U5 GGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCAAGCC
ARe73D06 pKA1U5 GGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCAAGCC
ARi68B04 pGCAP10 GAGCTGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCA
ARi71F10 pGCAP10 GAGCTGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCA
ARiS045E12 pGCAP10 TANCTGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCA
ARiS055H09 pGCAP10 GAGCTGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCA
ARiS087F17 pGCAP10
RBb21A08 pKA1U5 GGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCAAGCC
RBb36B09 pGCAP1 GGCTGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCAA
RBb51A04 pGCAP1 AATGTGAGCTGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCA
RBb72G01 pGCAP1 GGCTGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCAA
RBd20E11 pGCAP10 AGCTGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCAA
RBd46B11 pGCAP10 GAGCTGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCA
RBdS007C17 pGCAP10 GAGCTGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCA
RBdS070O21 pGCAP10 GAGCTGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCA
RBdS075N04 pGCAP10 GGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCAAGCC
RBdS110C15 pGCAP10 GAGCTGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCA
RBdS154K22 pGCAP10 GGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCAAGCC
RBdS187I09 pGCAP10 GGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCAAGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl