Prev. |  KEGG KO K05611 > 

RIKEN DNA Bank Human Resource - UCHL1

Gene ID NCBI Gene 7345 |  KEGG hsa:7345
Gene Symbol UCHL1
Protein Name ubiquitin C-terminal hydrolase L1
Synonyms HEL-117|HEL-S-53|NDGOA|PARK5|PGP 9.5|PGP9.5|PGP95|SPG79|Uch-L1
Ortholog resources KEGG ortholog (KEGG orthology K05611) in the DNA Bank
Featured content Parkinson disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080603 IRAL001I11 pOTB7 BC000332 NM_004181
HGY083714 IRAL009E18 pOTB7 BC005117 NM_004181 Full
HGY086863 IRAL017C15 pOTB7 BC006305 NM_004181 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048572 ARe21H04 pKA1U5 NM_004181.3  
GGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCAAGCC
HKR069278 ARe73D06 pKA1U5 NM_004181.3  
GGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCAAGCC
HKR187228 ARi68B04 pGCAP10 NM_004181.3  
GAGCTGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCA
HKR188530 ARi71F10 pGCAP10 NM_004181.3  
GAGCTGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCA
HKR218108 ARiS045E12 pGCAP10 NM_004181.3  
TANCTGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCA
HKR222177 ARiS055H09 pGCAP10 NM_004181.3  
GAGCTGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCA
HKR234937 ARiS087F17 pGCAP10 NM_004181.3  
HKR328408 RBb21A08 pKA1U5 NM_004181.3  
GGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCAAGCC
HKR334433 RBb36B09 pGCAP1 NM_004181.3  
GGCTGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCAA
HKR340404 RBb51A04 pGCAP1 NM_004181.3  
AATGTGAGCTGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCA
HKR348945 RBb72G01 pGCAP1 NM_004181.3  
GGCTGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCAA
HKR368107 RBd20E11 pGCAP10 NM_004181.3  
AGCTGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCAA
HKR378435 RBd46B11 pGCAP10 NM_004181.3  
GAGCTGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCA
HKR402865 RBdS007C17 pGCAP10 NM_004181.3  
GAGCTGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCA
HKR428357 RBdS070O21 pGCAP10 NM_004181.3  
GAGCTGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCA
HKR430316 RBdS075N04 pGCAP10 NM_004181.3  
GGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCAAGCC
HKR444063 RBdS110C15 pGCAP10 NM_004181.3  
GAGCTGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCA
HKR461862 RBdS154K22 pGCAP10 NM_004181.3  
GGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCAAGCC
HKR475001 RBdS187I09 pGCAP10 NM_004181.3  
GGTTTTTCGTCTTCCCTAGGCTATTTCTGCCGGGCGCTCCGCGAAGATGCAGCTCAAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl