Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02672

HP ID(1) HP02672
Gene ID(2) 11333
Gene Symbol finder PDAP1
Protein Name PDGFA associated protein 1
RefSeq NM_014891.5
Length of RefSeq (bp) 2383
Chromosome 7q22.1
Reference DDBJ accession
UniGene Hs.632296

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi03D11 pGCAP10 GATTCCGGTTCCGGTGTCAGTTCGAGGCGCCGCCGCCGCCGCCGCAGCCGCCGGAGCCGC
ARi62D11 pGCAP10 GNNGCCGCCGCCGCCGCCGCAGCCGCCGGAGCCGCAATGCCTAAAGGAGGANNAAGGGAG
ARiS198H21 pGCAP10
RBb14B09 pKA1U5 GCCGGTGTCAGTTCGAGGCGCCGCCGCCGCCGCCGCANCCGCCGGAGCCGCAATGCCTAA
RBb14B12 pKA1U5 GTCCGGATGTCAGTTCNAGGCGCCGCCGCCGCCGCCGCANCCGCCGGAGCCGCAATGCCT
RBb24E12 pGCAP1
RBd14C02 pGCAP10
RBdS014B12 pGCAP10 GNNTTNCGGTTCNNCNGNGNNNNNNTGGCNTGNNCNCNNNCCNNNNNNNANNNNGANNNN
RBdS051K11 pGCAP10 GGNNCCCCCGCCNCCGCCGCNNCCGCCGGAGCCGCNNTGCCNAAAGGAGGAAGAANGGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl