Prev. | 

RIKEN DNA Bank Human Resource - PDAP1

Gene ID NCBI Gene 11333 |  KEGG hsa:11333
Gene Symbol PDAP1
Protein Name PDGFA associated protein 1
Synonyms HASPP28|PAP|PAP1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001650 IRAK004C02 pCMV-SPORT6 BC001578 NM_014891
HGX007634 IRAK019B10 pCMV-SPORT6 BC039130 NM_014891 Partial
HGY082268 IRAL005L04 pOTB7 BC000684 NM_014891 Full
HGY088358 IRAL020O22 pOTB7 BC007873 NM_014891 Full
HGY103505 IRAL058M17 pOTB7 BC071993 NM_014891 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE100045 M01C050B21 pDONR221 MGC14-G11 BC000684 NM_014891  
HGE100093 M01C050D21 pDONR221 MGC14-G11 BC000684 NM_014891  
HGE100141 M01C050F21 pDONR221 MGC14-G11 BC000684 NM_014891  
HGE100189 M01C050H21 pDONR221 MGC14-G11 BC000684 NM_014891  
HGE100237 M01C050J21 pDONR221 MGC14-G11 BC000684 NM_014891  
HGE100285 M01C050L21 pDONR221 MGC14-G11 BC000684 NM_014891  
HGE100333 M01C050N21 pDONR221 MGC14-G11 BC000684 NM_014891  
HGE100381 M01C050P21 pDONR221 MGC14-G11 BC000684 NM_014891  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR161283 ARi03D11 pGCAP10 NM_014891.5  
GATTCCGGTTCCGGTGTCAGTTCGAGGCGCCGCCGCCGCCGCCGCAGCCGCCGGAGCCGC
HKR184883 ARi62D11 pGCAP10 NM_014891.5  
GNNGCCGCCGCCGCCGCCGCAGCCGCCGGAGCCGCAATGCCTAAAGGAGGANNAAGGGAG
HKR279389 ARiS198H21 pGCAP10 NM_014891.5  
HKR325633 RBb14B09 pKA1U5 NM_014891.5  
GCCGGTGTCAGTTCGAGGCGCCGCCGCCGCCGCCGCANCCGCCGGAGCCGCAATGCCTAA
HKR325636 RBb14B12 pKA1U5 NM_014891.5  
GTCCGGATGTCAGTTCNAGGCGCCGCCGCCGCCGCCGCANCCGCCGGAGCCGCAATGCCT
HKR329708 RBb24E12 pGCAP1 NM_014891.5  
HKR365650 RBd14C02 pGCAP10 NM_014891.5  
HKR405636 RBdS014B12 pGCAP10 NM_014891.5  
GNNTTNCGGTTCNNCNGNGNNNNNNTGGCNTGNNCNCNNNCCNNNNNNNANNNNGANNNN
HKR420651 RBdS051K11 pGCAP10 NM_014891.5  
GGNNCCCCCGCCNCCGCCGCNNCCGCCGGAGCCGCNNTGCCNAAAGGAGGAAGAANGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl