Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02670

HP ID(1) HP02670
Gene ID(2) 84617
Gene Symbol finder TUBB6
Protein Name tubulin, beta 6
RefSeq NM_032525.1
Length of RefSeq (bp) 1843
Chromosome 18p11.21
Reference DDBJ accession
UniGene Hs.193491

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe02A06 pKA1U5 GAGTTGCCGCTGTCGTCCGCAGAGCCAGTTCCTATCGCAGAGCCGCGCCCGCCATGAGGG
ARe08D05 pKA1U5 GAGAGCCAGTTCCTATCGCAGAGCCGCGCCCGCCATGAGGGAGATCGTGCACATCCAGGC
ARe15C02 pKA1U5 GGCTGTCGTCCGCAGAGCCAGTTCCTATCGCAGAGCCGCGCCCGCCATGAGGGAGATCGT
ARe97B10 pKA1U5 GGTTGCCGCTGTCGTCCGCAGAGCCAGTTCCTATCGCAGAGCCGCGCCCGCCATGAGGGA
ARf02G09 pKA1U5 TGAGAGCCGCGCCCGCCATGAGGGAGATCGTGCACATCCAGGCGGGCCAGTGCGGGAACC
ARf02H01 pKA1U5 TAGTTGCCGCTGTCGTCCGCAGAGCCAGTTCCTATCGCAGAGCCGCGCCCGCCATGAGGG
ARi43A05 pGCAP10 GAGTTGCCGCTGTCGTCCGCAGAGCCAGTTCCTATCGCAGAGCCGCGCCCGCCATGAGGG
ARi62E02 pGCAP10 GGCTGTCGTCCGCAGAGCCAGTTCCTAGCGCAGAGCCGCGCCCGCCATGAGGGAGATCGT
ARiS161L11 pGCAP10 AGTAGTCNCTGTCGTCCGCNNAGCCNGTTCCTAGCGCAGAGCCGCGCCCGCCATGAGGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl