Prev. |  KEGG KO K07375 > 

RIKEN DNA Bank Human Resource - TUBB6

Gene ID NCBI Gene 84617 |  KEGG hsa:84617
Gene Symbol TUBB6
Protein Name tubulin beta 6 class V
Synonyms FPVEPD|HsT1601|TUBB-5
Ortholog resource in our bank

  TUBB6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084945 IRAL012G01 pOTB7 BC002654 NM_032525

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR040806 ARe02A06 pKA1U5 NM_032525.1  
GAGTTGCCGCTGTCGTCCGCAGAGCCAGTTCCTATCGCAGAGCCGCGCCCGCCATGAGGG
HKR043277 ARe08D05 pKA1U5 NM_032525.1  
GAGAGCCAGTTCCTATCGCAGAGCCGCGCCCGCCATGAGGGAGATCGTGCACATCCAGGC
HKR046050 ARe15C02 pKA1U5 NM_032525.1  
GGCTGTCGTCCGCAGAGCCAGTTCCTATCGCAGAGCCGCGCCCGCCATGAGGGAGATCGT
HKR078834 ARe97B10 pKA1U5 NM_032525.1  
GGTTGCCGCTGTCGTCCGCAGAGCCAGTTCCTATCGCAGAGCCGCGCCCGCCATGAGGGA
HKR080953 ARf02G09 pKA1U5 NM_032525.1  
TGAGAGCCGCGCCCGCCATGAGGGAGATCGTGCACATCCAGGCGGGCCAGTGCGGGAACC
HKR080969 ARf02H01 pKA1U5 NM_032525.1  
TAGTTGCCGCTGTCGTCCGCAGAGCCAGTTCCTATCGCAGAGCCGCGCCCGCCATGAGGG
HKR177205 ARi43A05 pGCAP10 NM_032525.1  
GAGTTGCCGCTGTCGTCCGCAGAGCCAGTTCCTATCGCAGAGCCGCGCCCGCCATGAGGG
HKR184898 ARi62E02 pGCAP10 NM_032525.1  
GGCTGTCGTCCGCAGAGCCAGTTCCTAGCGCAGAGCCGCGCCCGCCATGAGGGAGATCGT
HKR264675 ARiS161L11 pGCAP10 NM_032525.1  
AGTAGTCNCTGTCGTCCGCNNAGCCNGTTCCTAGCGCAGAGCCGCGCCCGCCATGAGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl