Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02661

HP ID(1) HP02661
Gene ID(2) 5464
Gene Symbol finder PPA1
Protein Name pyrophosphatase (inorganic) 1
RefSeq NM_021129.3
Length of RefSeq (bp) 1316
Chromosome 10q11.1-q24
Reference DDBJ accession
UniGene Hs.437403

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe38G10 pKA1U5 GCCTTGTCAGTCGGCGCCGCGTGCGGGCTGGTGGCTCTGTGGCAGCGGCGGCGGCAGGAC
ARe44B02 pKA1U5 GCTCTCCTTGTCAGTCGGCGCCGCGTGCGGGCTGGTGGCTCTGTGGCAGCGGCGGCGGCA
ARf07A09 pKA1U5 GGTCAGTCGGCGCCGCGTGCGGGCTGGTGGCTCTGTGGCAGCGGCGGCGGCAGGACTCCG
ARiS087D08 pGCAP10 GAGTGCTCGCAGTGCGCAGGCGTGGGGCTCTCTCCTTGTCAGTCGGCGCCGCGTGCGGGC
ARiS109J22 pGCAP10 GGTCAGTCGGCGCCGCGTGCGGGCTGGTGGCTCTGTGGCAGCGGCGGCGGCAGGCCTCCG
ARiS109M21 pGCAP10 GGGTCCAGTGCTCGCAGTGCGCAGGCGTGGGGCTCTCTCCTTGTCAGTCGGCGCCGCGTG
RBb10G03 pKA1U5 GCCTTGATCAGCTCGGCGCCGCGTGCGGGCTGGTGGCTCTGTGGCAGCGGCGGCGGCAGG
RBb40D11 pGCAP1 GGGGCTGGTGGCTCTGTGGCAGCGGCGGCGGCAGGACTCCGGCACTATGAGCGGCTTCAG
RBb67G02 pGCAP1 GGCGCAGGCGTGGGGCTCTCTCCTTGTCAGTCGGCGCCGCGTGCGGGCTGGTGGCTCTGT
RBb72A04 pGCAP1 GCTCCTTGTCAGTCGGCGCCGCGTGCGGGCTGGTGGCTCTGTGGCAGCGGCGGCGGCAGG
RBd03F10 pGCAP10 GGTCAGTCGGCGCCGCGTGCGGGCTGGTGGCTCTGTGGCAGCGGCGGCGGCAGGACTCCG
RBd43E05 pGCAP10
RBd43F05 pGCAP10 GCCTTGTCAGTCGGCGCCGCGTGCGGGCTGGTGGCTCTGTGGCAGCGGCGGCGGCAGGAC
RBd43H10 pGCAP10 GCCTTGTCAGTCGGCGCCGCGTGCGGGCTGGTGGCTCTGTGGCAGCGGCGGCGGCAGGAC
RBd50H02 pGCAP10 GGTGGCAGCGGCGGCGGCAGGACTCCGGCACTATGAGCGGCTTCAGCACCGAGGAGCGCG
RBd57F11 pGCAP10 GCCTTGTCAGTCGGCGCCGCGTGCGGGCTGGTGGCTCTGTGGCAGCGGCGGCGGCAGGAC
RBd58B11 pGCAP10 GAGTGCTCGCAGTGCGCAGGCGTGGGGGCTCTCTCCTTGTCAGTCGGCGCCGCGTGCGGG
RBdS013K16 pGCAP10 GCTCTCCTTGTCAGTCGGCGCCGCGTGCGGGCTGGTGGCTCTGTGGCAGCGGCGGCGGCA
RBdS105A02 pGCAP10 GCTCTCCTTGTCAGTCGGCGCCGCGTGCGGGCTGGTGGCTCTGTGGCAGCGGCGGCGGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl