Prev. |  KEGG KO K01507 > 

RIKEN DNA Bank Human Resource - PPA1

Gene ID NCBI Gene 5464 |  KEGG hsa:5464
Gene Symbol PPA1
Protein Name pyrophosphatase (inorganic) 1
Synonyms HEL-S-66p|IOPPP|PP|PP1|SID6-8061
Ortholog resources KEGG ortholog (KEGG orthology K01507) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056663 IRAK141K23 pCMV-SPORT6 BC061581 NM_021129 Full
HGY082331 IRAL005N19 pOTB7 BC001022 NM_021129 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR055354 ARe38G10 pKA1U5 NM_021129.3  
GCCTTGTCAGTCGGCGCCGCGTGCGGGCTGGTGGCTCTGTGGCAGCGGCGGCGGCAGGAC
HKR057626 ARe44B02 pKA1U5 NM_021129.3  
GCTCTCCTTGTCAGTCGGCGCCGCGTGCGGGCTGGTGGCTCTGTGGCAGCGGCGGCGGCA
HKR082809 ARf07A09 pKA1U5 NM_021129.3  
GGTCAGTCGGCGCCGCGTGCGGGCTGGTGGCTCTGTGGCAGCGGCGGCGGCAGGACTCCG
HKR234880 ARiS087D08 pGCAP10 NM_021129.3  
GAGTGCTCGCAGTGCGCAGGCGTGGGGCTCTCTCCTTGTCAGTCGGCGCCGCGTGCGGGC
HKR243838 ARiS109J22 pGCAP10 NM_021129.3  
GGTCAGTCGGCGCCGCGTGCGGGCTGGTGGCTCTGTGGCAGCGGCGGCGGCAGGCCTCCG
HKR243909 ARiS109M21 pGCAP10 NM_021129.3  
GGGTCCAGTGCTCGCAGTGCGCAGGCGTGGGGCTCTCTCCTTGTCAGTCGGCGCCGCGTG
HKR324147 RBb10G03 pKA1U5 NM_021129.3  
GCCTTGATCAGCTCGGCGCCGCGTGCGGGCTGGTGGCTCTGTGGCAGCGGCGGCGGCAGG
HKR336083 RBb40D11 pGCAP1 NM_021129.3  
GGGGCTGGTGGCTCTGTGGCAGCGGCGGCGGCAGGACTCCGGCACTATGAGCGGCTTCAG
HKR346946 RBb67G02 pGCAP1 NM_021129.3  
GGCGCAGGCGTGGGGCTCTCTCCTTGTCAGTCGGCGCCGCGTGCGGGCTGGTGGCTCTGT
HKR348804 RBb72A04 pGCAP1 NM_021129.3  
GCTCCTTGTCAGTCGGCGCCGCGTGCGGGCTGGTGGCTCTGTGGCAGCGGCGGCGGCAGG
HKR361330 RBd03F10 pGCAP10 NM_021129.3  
GGTCAGTCGGCGCCGCGTGCGGGCTGGTGGCTCTGTGGCAGCGGCGGCGGCAGGACTCCG
HKR377301 RBd43E05 pGCAP10 NM_021129.3  
HKR377325 RBd43F05 pGCAP10 NM_021129.3  
GCCTTGTCAGTCGGCGCCGCGTGCGGGCTGGTGGCTCTGTGGCAGCGGCGGCGGCAGGAC
HKR377378 RBd43H10 pGCAP10 NM_021129.3  
GCCTTGTCAGTCGGCGCCGCGTGCGGGCTGGTGGCTCTGTGGCAGCGGCGGCGGCAGGAC
HKR380170 RBd50H02 pGCAP10 NM_021129.3  
GGTGGCAGCGGCGGCGGCAGGACTCCGGCACTATGAGCGGCTTCAGCACCGAGGAGCGCG
HKR382931 RBd57F11 pGCAP10 NM_021129.3  
GCCTTGTCAGTCGGCGCCGCGTGCGGGCTGGTGGCTCTGTGGCAGCGGCGGCGGCAGGAC
HKR383235 RBd58B11 pGCAP10 NM_021129.3  
GAGTGCTCGCAGTGCGCAGGCGTGGGGGCTCTCTCCTTGTCAGTCGGCGCCGCGTGCGGG
HKR405456 RBdS013K16 pGCAP10 NM_021129.3  
GCTCTCCTTGTCAGTCGGCGCCGCGTGCGGGCTGGTGGCTCTGTGGCAGCGGCGGCGGCA
HKR442002 RBdS105A02 pGCAP10 NM_021129.3  
GCTCTCCTTGTCAGTCGGCGCCGCGTGCGGGCTGGTGGCTCTGTGGCAGCGGCGGCGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl