Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02616

HP ID(1) HP02616
Gene ID(2) 10016
Gene Symbol finder PDCD6
Protein Name programmed cell death 6
RefSeq NM_013232.3
Length of RefSeq (bp) 1151
Chromosome 5p15.33
Reference DDBJ accession
UniGene Hs.50823

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe49E12 pKA1U5 GGGAGTCGGCCTGAGAGGTCTCTCGTCGCTGCAGGCGCCTCAGCCCAGCCGCGTGCCTTG
ARf03E10 pKA1U5 GAGAGGCGGAAGCGGAGTCGGCCTGAGAGGTCTCTCGTCGCTGCAGGCGCCTCAGCCCAG
ARi02E04 pGCAP10 GAGAGGCGGAAGCGGAGTCGGCCTGAGAGGTCTCTCGTCGCTGCAGGCGCCTCAGCCCAG
ARi46A07 pGCAP10 GAGAGGCGGAAGCGGAGTCGGCCTGAGAGGTCTCTCGTCGCTGCAGGCGCCTCAGCCCAG
RBb35C10 pGCAP1 GGAGGGGTCGCCAGTCGCCGCAGGCGCTTCAGCCCAGCGGCGGGCCTTGGCCCTTGGCTG
RBd56A03 pGCAP10 GAGAGGCGGAAGCGGAGTCGGCCTGAGAGGTCTCTCGTCGCNNNNNNCGCCTCAGCCCAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl