Prev. | 

RIKEN DNA Bank Human Resource - PDCD6

Gene ID NCBI Gene 10016 |  KEGG hsa:10016
Gene Symbol PDCD6
Protein Name programmed cell death 6
Synonyms ALG-2|ALG2|PEF1B
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008477 IRAK021D05 pCMV-SPORT6 BC012384 NM_013232 Full
HGY013319 IRAK033E23 pBluescriptR BC014604 NM_013232 Partial/var
HGX035756 IRAK089G12 pCMV-SPORT6 BC044220 NM_013232 Partial/var
HGY042764 IRAK106P04 pBluescript BC045555 NM_013232 Partial/var
HGX046108 IRAK115E12 pCMV-SPORT6 BC053586 NM_013232 Partial/var
HGY067083 IRAK167L19 pBluescriptR BC067863 NM_013232 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR059708 ARe49E12 pKA1U5 NM_013232.3  
GGGAGTCGGCCTGAGAGGTCTCTCGTCGCTGCAGGCGCCTCAGCCCAGCCGCGTGCCTTG
HKR081306 ARf03E10 pKA1U5 NM_013232.3  
GAGAGGCGGAAGCGGAGTCGGCCTGAGAGGTCTCTCGTCGCTGCAGGCGCCTCAGCCCAG
HKR160900 ARi02E04 pGCAP10 NM_013232.3  
GAGAGGCGGAAGCGGAGTCGGCCTGAGAGGTCTCTCGTCGCTGCAGGCGCCTCAGCCCAG
HKR178407 ARi46A07 pGCAP10 NM_013232.3  
GAGAGGCGGAAGCGGAGTCGGCCTGAGAGGTCTCTCGTCGCTGCAGGCGCCTCAGCCCAG
HKR334058 RBb35C10 pGCAP1 NM_013232.3  
GGAGGGGTCGCCAGTCGCCGCAGGCGCTTCAGCCCAGCGGCGGGCCTTGGCCCTTGGCTG
HKR382403 RBd56A03 pGCAP10 NM_013232.3  
GAGAGGCGGAAGCGGAGTCGGCCTGAGAGGTCTCTCGTCGCNNNNNNCGCCTCAGCCCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl