Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02611

HP ID(1) HP02611
Gene ID(2) 9094
Gene Symbol finder UNC119
Protein Name unc-119 homolog (C. elegans)
RefSeq NM_054035.2
Length of RefSeq (bp) 1665
Chromosome 17q11.2
Reference DDBJ accession
UniGene Hs.410455

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb24D07 pGCAP1 AB593014 GCTCCCACTTCCCCCGGCTCCAGCCGGCGCAGGCAGCGGCGGCAGCAGCAGGCGAGCCTC
RBd77B04 pGCAP10 GAGCGGCGGCAGCAGCAGGCGAGCCTCGGCCCCGCAAGGCCATGAAGGTGAAGAAGGGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl