RBb24D07 - NRCD Human cDNA Clone

Catalog Number HKR329679 Clone Name RBb24D07 Clone info. Plasmid clone of human UNC119 cDNA with SV40 promoter Vector(1) pGCAP1 5'-terminal sequence(2) GCTCCCACTTCCCCCGGCTCCAGCCGGCGCAGGCAGCGGCGGCAGCAGCAGGCGAGCCTC Sequence, submitted(3) AB593014 [link] Note Full cds when compared using AB593014   Sequence, refered NM_054035.2 (NCBI RefSeq mRNA) Gene Symbol and ID(4) UNC119 (NCBI Gene 9094)  other clone of UNC119 in our bank Synonyms CORD24|HRG4|IMD13|POC7|POC7A Protein Name unc-119 lipid binding chaperone

Links   KEGG   NCBI Gene   NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

How to cite this biological resource

Materials & Methods section:

Sequence information

Restriction map is not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference

2023.07.07