Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02525

HP ID(1) HP02525
Gene ID(2) 27247
Gene Symbol finder NFU1
Protein Name NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)
RefSeq NM_001002755.1
Length of RefSeq (bp) 1091
Chromosome 2p15-p13
Reference DDBJ accession
UniGene Hs.430439

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi27G10 pGCAP10 GACTCCGGACTAAGATGGCGGCGACGGCCAGGCGGGGCTGGGGAGCTGCGGCTGTTGCCG
ARi66A06 pGCAP10 GACTCCGGACTAAGATGGCGGCGACGGCCAGGCGGGGCTGGGGAGCTGCGGCTGTTGCCG
ARi67C07 pGCAP10 GACTCCGGACTAAGATGGCGGCGACGGCCAGGCGGGGCTGGGGAGCTGCGGCTGTTGCCG
ARiS150F24 pGCAP10 CGGCCGGCCGATTCTCCGGACTAAGATGGCGGCGACGGCCAGGCGGGGCTGGGGAGCTGC
RBb07F09 pKA1U5 GACTCCGGACTAAGATGGCGGCGACGGCCAGGCGGGGCTGGGGAGCTGCGGCTGTTGCCG
RBd31B11 pGCAP10 GACTCCGGACTAAGATGGCGGCGACGGCCACGCGGGGCTGGGGAGCTGCGGCTGATGCCG
RBd79H05 pGCAP10 GAGGCACTCCGGACTAAGATGGCGGCGACGGCCAGGCGGGGCTGGGGAGCTGCGGCTGTT
RBdS083L14 pGCAP10 GACTCCGGACTAAGATGGCGGCGACGGCCAGGCGGGGCTGGGGAGCTGCGGCTGTTGCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl