Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NFU1

Gene ID (NCBI) 27247
Gene Symbol NFU1
Protein Name NFU1 iron-sulfur cluster scaffold
Synonyms CGI-33|HIRIP|HIRIP5|MMDS1|NIFUC|Nfu|NifU
Databases KEGG hsa:27247 |  NCBI Gene 27247


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR170954 ARi27G10 pGCAP10 NM_001002755.1  
GACTCCGGACTAAGATGGCGGCGACGGCCAGGCGGGGCTGGGGAGCTGCGGCTGTTGCCG
HKR186406 ARi66A06 pGCAP10 NM_001002755.1  
GACTCCGGACTAAGATGGCGGCGACGGCCAGGCGGGGCTGGGGAGCTGCGGCTGTTGCCG
HKR186855 ARi67C07 pGCAP10 NM_001002755.1  
GACTCCGGACTAAGATGGCGGCGACGGCCAGGCGGGGCTGGGGAGCTGCGGCTGTTGCCG
HKR260144 ARiS150F24 pGCAP10 NM_001002755.1  
CGGCCGGCCGATTCTCCGGACTAAGATGGCGGCGACGGCCAGGCGGGGCTGGGGAGCTGC
HKR322929 RBb07F09 pKA1U5 NM_001002755.1  
GACTCCGGACTAAGATGGCGGCGACGGCCAGGCGGGGCTGGGGAGCTGCGGCTGTTGCCG
HKR372435 RBd31B11 pGCAP10 NM_001002755.1  
GACTCCGGACTAAGATGGCGGCGACGGCCACGCGGGGCTGGGGAGCTGCGGCTGATGCCG
HKR391773 RBd79H05 pGCAP10 NM_001002755.1  
GAGGCACTCCGGACTAAGATGGCGGCGACGGCCAGGCGGGGCTGGGGAGCTGCGGCTGTT
HKR433478 RBdS083L14 pGCAP10 NM_001002755.1  
GACTCCGGACTAAGATGGCGGCGACGGCCAGGCGGGGCTGGGGAGCTGCGGCTGTTGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl