Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02515

HP ID(1) HP02515
Gene ID(2) 50999
Gene Symbol finder TMED5
Protein Name transmembrane emp24 protein transport domain containing 5
RefSeq NM_016040.3
Length of RefSeq (bp) 3969
Chromosome 1pter-q31.3
Reference DDBJ accession
UniGene Hs.482873

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS022J11 pGCAP10 GGGGAGTGTTCGCCGCCGCCGCGGCCGCCACCTGGAGTTTCTTCAGACTCCAGATTTCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl