Prev. |  KEGG KO K14825 > 

RIKEN DNA Bank Human Resource - TMED5

Gene ID NCBI Gene 50999 |  KEGG hsa:50999
Gene Symbol TMED5
Protein Name transmembrane p24 trafficking protein 5
Synonyms CGI-100|p24g2|p28
Ortholog resource in our bank

  TMED5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001341 IRAK003F21 pCMV-SPORT6 BC016556 NM_016040 Full
HGY067063 IRAK167K23 pBluescriptR BC070051 NM_016040
HGY092815 IRAL032A15 pDNR-LIB BC016365 NM_016040 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE017370 W01A043H02 pENTR-TOPO IRAK003F21 BC016556 NM_016040  
HGE017372 W01A043H04 pENTR-TOPO IRAK003F21 BC016556 NM_016040  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR409027 RBdS022J11 pGCAP10 NM_016040.3  
GGGGAGTGTTCGCCGCCGCCGCGGCCGCCACCTGGAGTTTCTTCAGACTCCAGATTTCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl