Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02491

HP ID(1) HP02491
Gene ID(2) 4942
Gene Symbol finder OAT
Protein Name ornithine aminotransferase (gyrate atrophy)
RefSeq NM_000274.2
Length of RefSeq (bp) 2066
Chromosome 10q26
Reference DDBJ accession
UniGene Hs.523332

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi07G08 pGCAP10 GGTTGCGCTTCATAGACGCCGCGTGTACCCGGTTGTCCTCAGGCGCTGTCAGATCTGTGG
ARiS161I03 pGCAP10 GGTTGCGCTTCATAGACGCCGCGTGTACCCGGTTGTCCTCAGGCGCTGTCAGATCTGTGG
RBb10B08 pKA1U5 GGTTGCGCTTCATAGACGCCGCGTGTACCCGGCTTGTCCTCAGGCGCTGTCAGATCTGTG
RBd85E08 pGCAP10 GGTTGCGCTTCATAGACGCCGCGTGTACCCGGTTGTCCTCAGGCGCTGTCAGATCTGTGG
RBdS040H16 pGCAP10 GGTTGCGCTTCATAGACGCCGCGTGTACCCGGTTGTCCTCAGGCGCTGTCAGATCTGTGG
RBdS156L08 pGCAP10 GGTTGCGCTTCATAGACGCCGCGTGTACCCGGTTGTCCTCAGGCGCTGTCAGATCTGTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl