Prev. |  KEGG KO K00819 > 

RIKEN DNA Bank Human Resource - OAT

Gene ID NCBI Gene 4942 |  KEGG hsa:4942
Gene Symbol OAT
Protein Name ornithine aminotransferase
Synonyms GACR|HOGA|OATASE|OKT
Ortholog resources KEGG ortholog (KEGG orthology K00819) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB05513 pKM2L-phOAT Promoter Bank clone, Human ornithine aminotransferase (OAT) promoter

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001570 IRAK003P10 pCMV-SPORT6 BC000964 NM_000274 Full
HGX009061 IRAK022K21 pCMV-SPORT6 BC016928 NM_000274 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR162952 ARi07G08 pGCAP10 NM_000274.2  
GGTTGCGCTTCATAGACGCCGCGTGTACCCGGTTGTCCTCAGGCGCTGTCAGATCTGTGG
HKR264595 ARiS161I03 pGCAP10 NM_000274.2  
GGTTGCGCTTCATAGACGCCGCGTGTACCCGGTTGTCCTCAGGCGCTGTCAGATCTGTGG
HKR324032 RBb10B08 pKA1U5 NM_000274.2  
GGTTGCGCTTCATAGACGCCGCGTGTACCCGGCTTGTCCTCAGGCGCTGTCAGATCTGTG
HKR394104 RBd85E08 pGCAP10 NM_000274.2  
GGTTGCGCTTCATAGACGCCGCGTGTACCCGGTTGTCCTCAGGCGCTGTCAGATCTGTGG
HKR416184 RBdS040H16 pGCAP10 NM_000274.2  
GGTTGCGCTTCATAGACGCCGCGTGTACCCGGTTGTCCTCAGGCGCTGTCAGATCTGTGG
HKR462672 RBdS156L08 pGCAP10 NM_000274.2  
GGTTGCGCTTCATAGACGCCGCGTGTACCCGGTTGTCCTCAGGCGCTGTCAGATCTGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl