Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02465

HP ID(1) HP02465
Gene ID(2) 5702
Gene Symbol finder PSMC3
Protein Name proteasome (prosome, macropain) 26S subunit, ATPase, 3
RefSeq NM_002804.4
Length of RefSeq (bp) 1618
Chromosome 11p12-p13
Reference DDBJ accession
UniGene Hs.250758

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe88G08 pKA1U5 GGACTCGGCAGGAGAAGATGGCGACCGTGTGGGATGAGGCCGAGCAAGATGGAATTGGGG
ARi12E05 pGCAP10 GAGTGACTCGGCAGGAGAAGATGGCGACCGTGTGGGATGAGGCCGAGCAAGATGGAATTG
ARiS013C02 pGCAP10 GACTCGGCAGGAGAAGATGGCGACCGTGTGGGATGAGGCCGAGCAAGATGGAATTGGGGA
ARiS194C05 pGCAP10 GGAGAGTCCAGTGACTCGGCAGGAGAAGATGGCGACCGTGTGGGATGAGGCCGAGCAAGA
RBb16G12 pKA1U5 GGACTCGGCAGGAGAAGATGGCGACCGTGTGGGATGAGGCCGAGCAAGATGGAATTGGGG
RBd25H12 pGCAP10 GGAGGCAGATTCGCTGCTCCGCAGCACGGCCGGAGCTGGTCCGGTCAAGAGTCGGGATTT
RBd27F02 pGCAP10 GGCCGAATATTGAGAGTCCAGTGACTCGGCAGGAGAAGATGGCGACCGTGTGGGATGAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl