Prev. |  KEGG KO K03065 > 

RIKEN DNA Bank Human Resource - PSMC3

Gene ID NCBI Gene 5702 |  KEGG hsa:5702
Gene Symbol PSMC3
Protein Name proteasome 26S subunit, ATPase 3
Synonyms TBP1
Ortholog resources KEGG ortholog (KEGG orthology K03065) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX069920 IRAK174N08 pCMV-SPORT6 BC073165 NM_002804 Full
HGY080566 IRAL001G22 pOTB7 BC008713 NM_002804 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE022287 W01A055L23 pENTR-TOPO IRAK174N08 BC073165 NM_002804  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR075352 ARe88G08 pKA1U5 NM_002804.4  
GGACTCGGCAGGAGAAGATGGCGACCGTGTGGGATGAGGCCGAGCAAGATGGAATTGGGG
HKR164901 ARi12E05 pGCAP10 NM_002804.4  
GAGTGACTCGGCAGGAGAAGATGGCGACCGTGTGGGATGAGGCCGAGCAAGATGGAATTG
HKR205250 ARiS013C02 pGCAP10 NM_002804.4  
GACTCGGCAGGAGAAGATGGCGACCGTGTGGGATGAGGCCGAGCAAGATGGAATTGGGGA
HKR277653 ARiS194C05 pGCAP10 NM_002804.4  
GGAGAGTCCAGTGACTCGGCAGGAGAAGATGGCGACCGTGTGGGATGAGGCCGAGCAAGA
HKR326556 RBb16G12 pKA1U5 NM_002804.4  
GGACTCGGCAGGAGAAGATGGCGACCGTGTGGGATGAGGCCGAGCAAGATGGAATTGGGG
HKR370180 RBd25H12 pGCAP10 NM_002804.4  
GGAGGCAGATTCGCTGCTCCGCAGCACGGCCGGAGCTGGTCCGGTCAAGAGTCGGGATTT
HKR370922 RBd27F02 pGCAP10 NM_002804.4  
GGCCGAATATTGAGAGTCCAGTGACTCGGCAGGAGAAGATGGCGACCGTGTGGGATGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl