Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02437

HP ID(1) HP02437
Gene ID(2) 57125
Gene Symbol finder PLXDC1
Protein Name plexin domain containing 1
RefSeq NM_020405.3
Length of RefSeq (bp) 6140
Chromosome 17q21.1
Reference DDBJ accession
UniGene Hs.125036

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd09A10 pGCAP10 GAGACGGTGGCCGAGCGGGGGACCGGGAAGCATGGCCCGGGGGTCGGCGGTTGCCTGGGC
RBd37G11 pGCAP10 GAGCGCCGCAGACGGTGGCCGAGCGGGGGACCGGGAAGCATGGCCCGGGGGTCGGCGGTT
RBd43F11 pGCAP10 GAGGGGTCCAGTCCTCGGGCCTTCTCTCTGCAGCTTTCCCGGCGGAACGGAGGAGGGAAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl