Prev. | 

RIKEN DNA Bank Human Resource - PLXDC1

Gene ID NCBI Gene 57125 |  KEGG hsa:57125
Gene Symbol PLXDC1
Protein Name plexin domain containing 1
Synonyms TEM3|TEM7
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY019534 IRAK048N22 pBluescriptR BC036059 NM_020405 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE007519 W01A018N07 pENTR-TOPO IRAK048N22 BC036059 NM_020405  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR363610 RBd09A10 pGCAP10 NM_020405.3  
GAGACGGTGGCCGAGCGGGGGACCGGGAAGCATGGCCCGGGGGTCGGCGGTTGCCTGGGC
HKR374955 RBd37G11 pGCAP10 NM_020405.3  
GAGCGCCGCAGACGGTGGCCGAGCGGGGGACCGGGAAGCATGGCCCGGGGGTCGGCGGTT
HKR377331 RBd43F11 pGCAP10 NM_020405.3  
GAGGGGTCCAGTCCTCGGGCCTTCTCTCTGCAGCTTTCCCGGCGGAACGGAGGAGGGAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl