Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02431

HP ID(1) HP02431
Gene ID(2) 9812
Gene Symbol finder KIAA0141
Protein Name KIAA0141
RefSeq NM_014773.2
Length of RefSeq (bp) 3056
Chromosome 5q31.3
Reference DDBJ accession
UniGene Hs.210532

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd78C06 pGCAP10 TGACTCGGCCACTCGGGGCATCGCGGCGGCCTTTCTAGCCGCTGTCCCAAGGGTTGGTCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl